Review



control empty vector  (OriGene)


Bioz Verified Symbol OriGene is a verified supplier
Bioz Manufacturer Symbol OriGene manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 97
      Buy from Supplier

    Structured Review

    OriGene control empty vector
    Control Empty Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 1858 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control empty vector/product/OriGene
    Average 97 stars, based on 1858 article reviews
    control empty vector - by Bioz Stars, 2026-02
    97/100 stars

    Images



    Similar Products

    control empty vector  (OriGene)
    97
    OriGene control empty vector
    Control Empty Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control empty vector/product/OriGene
    Average 97 stars, based on 1 article reviews
    control empty vector - by Bioz Stars, 2026-02
    97/100 stars
    		  Buy from Supplier
    pcmv6 entry empty vector  (OriGene)
    97
    OriGene pcmv6 entry empty vector
    Pcmv6 Entry Empty Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcmv6 entry empty vector/product/OriGene
    Average 97 stars, based on 1 article reviews
    pcmv6 entry empty vector - by Bioz Stars, 2026-02
    97/100 stars
    		  Buy from Supplier
    pcmv6-entry empty vectors  (OriGene)
    90
    OriGene pcmv6-entry empty vectors
    Pcmv6 Entry Empty Vectors, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcmv6-entry empty vectors/product/OriGene
    Average 90 stars, based on 1 article reviews
    pcmv6-entry empty vectors - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    pcmv6 entry empty vectors  (OriGene)
    97
    OriGene pcmv6 entry empty vectors
    Pcmv6 Entry Empty Vectors, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcmv6 entry empty vectors/product/OriGene
    Average 97 stars, based on 1 article reviews
    pcmv6 entry empty vectors - by Bioz Stars, 2026-02
    97/100 stars
    		  Buy from Supplier
    pcmv entry myc ddk empty vector  (OriGene)
    97
    OriGene pcmv entry myc ddk empty vector
    Pcmv Entry Myc Ddk Empty Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcmv entry myc ddk empty vector/product/OriGene
    Average 97 stars, based on 1 article reviews
    pcmv entry myc ddk empty vector - by Bioz Stars, 2026-02
    97/100 stars
    		  Buy from Supplier
    pcmv6 ac gfp empty vector  (OriGene)
    96
    OriGene pcmv6 ac gfp empty vector

    Pcmv6 Ac Gfp Empty Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcmv6 ac gfp empty vector/product/OriGene
    Average 96 stars, based on 1 article reviews
    pcmv6 ac gfp empty vector - by Bioz Stars, 2026-02
    96/100 stars
    		  Buy from Supplier
    empty plasmid pcmv6 entry  (OriGene)
    97
    OriGene empty plasmid pcmv6 entry

    Empty Plasmid Pcmv6 Entry, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/empty plasmid pcmv6 entry/product/OriGene
    Average 97 stars, based on 1 article reviews
    empty plasmid pcmv6 entry - by Bioz Stars, 2026-02
    97/100 stars
    		  Buy from Supplier
    empty vector  (OriGene)
    97
    OriGene empty vector

    Empty Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/empty vector/product/OriGene
    Average 97 stars, based on 1 article reviews
    empty vector - by Bioz Stars, 2026-02
    97/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: iScience

    Article Title: Acetyl-NPKY of integrin-β1 binds KINDLIN2 to control endothelial cell proliferation and junctional integrity

    doi: 10.1016/j.isci.2024.110129

    Figure Lengend Snippet:

    Article Snippet: We first transferred the full cDNA sequence of human KINDLIN2 with the following primers (fwd: CTCGCGAGCCCGCATGGCTCTGGACGGG and rev: GTACCTCGAGCACCCAACCACTGGTAAG) from a N-terminal tagging pCMV-CFP-KIND2 plasmid into a pCMV6-AC-GFP empty vector (ref. PS100010, Origene) with a C-terminal tagging turboGFP by using PrimeSTAR Max DNA polymerase (ref R045A, TAKARA).

    Techniques: Virus, Recombinant, Synthesized, Real-time Polymerase Chain Reaction, Plasmid Preparation, Software